Zwiększona częstość występowania trombofilii genetycznej u kobiet z powikłaniami ciąży cd

Kobiety w obu grupach zostały zarejestrowane w szpitalu po porodzie. Na podstawie rejestracji pobrano krew od wszystkich kobiet do analizy DNA pod kątem mutacji zakrzepowych. W tym czasie zainicjowano badanie kobiet, których ciąże były komplikowane przez opóźnienie wzrostu płodu lub poród martwego płodu (np. Przeprowadzono test cytomegalowirusa i autopsję martwo urodzonych niemowląt). Kobiety zostały następnie poproszone o powrót co najmniej dwa miesiące po porodzie, w którym to czasie pobrano krew do oceny białka S, białka C, antytrombiny III, przeciwciał antykardiolipinowych i antykoagulanta toczniowego. Wszystkie kobiety otrzymały opiekę prenatalną, która jest objęta obowiązkowym ubezpieczeniem zdrowotnym dla wszystkich obywateli Izraela.
Diagnostyka molekularna
Diagnostykę molekularną mutacji czynnika V Leiden przeprowadzono w sposób opisany przez Brennera i wsp. [18]. Mutację genu reduktazy metylenotetrahydrofolianowej wykryto w sposób opisany przez Frossta i wsp. [11]. Mutację w genie protrombiny wykrywano przy użyciu niewielkiej modyfikacji metoda Poorta i wsp.13. Startem do przodu był 5 CAACCGCTGGTATCAAATGG3 , a starter odwrotny był taki jak opisali Poort i wsp. 13. Ta metoda dała fragment DNA o 253 parach zasad, który strawiono Hin dIII.
Testy
Wolne białko S w osoczu mierzono specyficznym enzymatycznym testem immunoabsorpcyjnym (test Asserachrom free protein S, Diagnostica Stago, Asni.res, Francja). Poziomy antygenu białka C i antygenu antytrombiny III określono za pomocą elektrofizjologicznego testu rakietowego za pomocą króliczego anty-ludzkiego białka C (Sigma, Rehovot, Izrael) i króliczej anty-ludzkiej antytrombiny III (Diagnostica Stago), odpowiednio. Aktywność antytrombiny III w osoczu została oznaczona za pomocą testu chromogennego (Dade Diagnostica, Monachium, Niemcy). Poziomy przeciwciał antykardiolipinowych IgG i IgM określono za pomocą testu immunoenzymatycznego (ORGenTec, Mainz, Niemcy); pomiar ponad 15 jednostek fosfolipidów IgG uznano za wynik pozytywny. Obecność antykoagulanta toczniowego została określona w sposób opisany w innym miejscu. [19] Dla wszystkich tych testów współczynniki zmienności wewnątrz testu i między testami wynosiły mniej niż 6 procent.
Analiza statystyczna
Wyniki dla obu grup porównano z użyciem dwustronnych testów t-Studenta, dokładnych testów Fishera i testów chi-kwadrat Pearsona. Określono stosunki kursów i 95-procentowe przedziały ufności. Analizy statystyczne przeprowadzono za pomocą Pakietu statystycznego dla nauk społecznych dla Windows, wersja 6 (SPSS, Chicago).
Wyniki
Tabela 1. Tabela 1. Charakterystyka kliniczna badanych kobiet. Charakterystykę kobiet z powikłaniami położniczymi i prawidłową ciążą przedstawiono w tabeli 1. Wiek ciążowy przy urodzeniu i masa urodzeniowa niemowląt były istotnie niższe, a liczba kobiet z grupy pierwotnej była istotnie wyższa w grupie z powikłaniami. Spośród 18 wieloródek z powikłaniami 12 miało komplikacje położnicze w poprzedniej ciąży, 3 miały jedną normalną ciążę i jedną skomplikowaną ciążę, a 3 miało normalną ciążę.
Trzydzieści cztery spośród 110 kobiet z powikłaniami (31 procent) miało ciężki stan przedrzucawkowy, wskazany przez ciśnienie krwi wyższe niż 160/110 mmHg u 26 kobiet; wydalanie białka z moczem przekraczające 5 g na 24 godziny w 2; liczba płytek krwi poniżej 100 000 na milimetr sześcienny w 2; połączenie hemolizy, wysokich stężeń aminotransferaz w surowicy i liczby płytek poniżej 100 000 na milimetr sześcienny w 3; i rzucawka w 1
[patrz też: suprasorb, ambroksol, alprazolam ]
[patrz też: Choroba Perthesa, przeciski pod drogami, blinatumomab ]
[hasła pokrewne: operacja kręgosłupa szyjnego, opiekun osoby starszej, orteza na kolano ]